SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20071
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf17
6395444 bp
UniRef
UniRef50_A0DX04 (29%/62)
Cluster: Chromosome undetermined scaffold_68, whole genome shotgun sequence; n=1; Paramecium tetraurelia|Rep: Chromosome undetermined scaffold_68, whole genome shotgun sequence - Paramecium tetraurelia
Ontology
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGGAAATAGTGATCTTTTTAAAAGAATGTCAAGCTAAGAATTATGAAGTGAT
GGAATATAAGACTGATAAGTCAAGACTTTTAGACTTAAATAAATATTTTGTCAACTAAGG
AGCTTATGCACATCTAGCAGGTGCCTGTCTAGCAAGCAATTTTCTGTATTTTGTTCTAAT
ACTAAATGTACAATACGTCCATCCCCTGTTAGTCTTTAGGCACTTAAATAAAATGTTTCT
ATTGCTGGAAATACACTTATTAAGTGGACAGAAAATAAGCCTGTGTCAGAATAAATTCCT
TTAATCAGCATGACATTTTTACTGTTTTATATATATTGTGACTTGAAAATGTGATAATGT
CTTTAGACCAAATGAAAAGAAAAATCATGTGGCTAAATATTTATTTTATTGAATATATTC
ATTATCTATGTGATTAAAATACTGCTACGTAACTTAAAAAAA
(462 bp)

- SilkBase 1999-2022 -