SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20070
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf61
2256882 bp
UniRef
UniRef50_Q8NCW5 (60%/88)
Cluster: Apolipoprotein A-I-binding protein precursor; n=32; Eukaryota|Rep: Apolipoprotein A-I-binding protein precursor - Homo sapiens (Human)
Ontology
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0008150 P biological_process
Orthologue
Sequence
(Nucleotide)
CGGCACGAGTTTGTAAATATGTAAATTAAAGAATAATACATAATAATACATATCATACCA
TTAAGTGTATAATCTATGATACCTACCTATATAGGTAACATGCACATAGGATTTAAATAA
AATATTATTTTAACTGACATTTGGAACCAAACTACGTATCTATTATTAGTAAAAGAAAAA
CAGTAAAAGAATCTTCTTAAATGTTATTGTACAGGTTGTTCGGGAGTGCTCTAATATTGC
GTGTAGCAAAACTGATAACATCGGAACTATGACGAGCAGTATGAATCAATGCAACACTGT
GACGCGGTACCTCAATCAGTCAGAAGCGGCAGCACTGGACCAGGATCTTTTCACTGAATA
CAAGTTTAGTGTCGATCAACTTATGGAACTTGCTGGCCTGAGTGTTGCTAGTGCCATTGC
CAAGGTCTTCCCACCCTCAACTCACTCATCAGCTCTTATAGTGTGCGGGCCAGGAAATAA
TGGAGGAGATGGTTTAGTAGCCGCAAGAATATGCAGTTGTTCGGATACAATGTATCGGTA
CATTATCCTAAACGCACACCCAAACCTTTGTATGAAAACCTTCTGGAACAATGCATAAGA
TTCAATGTTAATATAATTGATAAATTACCAGACACTAAA
(639 bp)

- SilkBase 1999-2022 -