SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20069
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_P11021 (86%/86)
Cluster: 78 kDa glucose-regulated protein precursor (GRP 78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+)-binding protein grp78); n=736; root|Rep: 78 kDa glucose-regulated protein precursor (GRP 78) (Heat shock 70 kDa protein 5) (Immunoglobulin heavy chain-binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+)-binding protein grp78) - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0005509 F calcium ion binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGAGAAGAGAACTATCTCGAGTTTTTCTTGAACAATTGAACGAAAAGTATCG
GTGTACTGTTTGAATACGCAAGTGTTTGATAAAAGCATTTTAAAGTGATCTTATCGTGGC
TGTGAATATAATTTTATTTAGATTTTTGTTAATTTCGGAGTCTTTTAATCTATAGATTTT
GCATGGTCAAGATGCGGTGGAGTTTGTTCGCGCTAGTTTTGGTGGTCGCGGCCGTTTGTG
CCGACGACAAGAAGAGAAAGATAAGGACATCGGCACAGTAATCGGTATCGATTTGGGTAC
CACTTACTCATGTGTCGGTGTCTACAAAAATGGACGTGTAGAAATCATTGCCAATGACCA
GGGAAACCGCATCACACCTTCATACGTGGCCTTCACTCAAGATGGTGAACGTTTAATTGG
TGATGCTGCCAAAAACCAGCTTACTACCAACCCTGAAAACACTGTCTTTGATGCCAAGCG
TCTGATTGGTCGTGAATGGAGTGACCAACTGTACAACATGATGTTAAGTTCTTCCCCTTC
AAGGTCGTTGAAAAGAACAGCAAACCTCATGTTCAAGTACAAACTTCACAAGGCGACAAA
GTATTTGCTCCTGAAGAAATCTCTGCTATGGTTCTG
(636 bp)

- SilkBase 1999-2022 -