SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20067
JBrowseBomo_Chr5
chromosome_No.
Scaffold_id
Scaffold Length
chromo5
Bm_scaf20
5834375 bp
UniRef
UniRef50_Q8MLT4 (50%/80)
Cluster: CG5820-PD, isoform D; n=9; Diptera|Rep: CG5820-PD, isoform D - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005515 F protein binding
GO:0005886 C plasma membrane
GO:0007185 P transmembrane receptor protein tyrosine phosphatase signaling pathway
GO:0048749 P compound eye development
GO:0016021 C integral component of membrane
Orthologue
Sequence
(Nucleotide)
GGCACGAGGAACATCGCTACTACGCAGTGCAAGATTCCAAAAATCAAGTGTAACCGTTAT
TGAGTGGCTGAACTGAAGTCAAAGAGTTCGCTACGACATGGGGGCAAGGTCCCGGGAGTT
ACTACTGCTCCTGGCAGCATGCGCGCTGGTATTCGGCGAATCTATCAATAAAACCGTCAA
GAAAGACAAAGACGCCGACAACTTATTGGATCAATATGAGGATTACGAACCCGCGGAATA
CCAAGAGGTTTTGTCAACGAGGACAGGCCCTGTCCCAGAGACTGCATATGCTCTGTATCT
CAGGGATACAGACAAGCCAAGTGCAGCTTCCTCGAAATCGGTACACAAAAGTTCGGCGAT
GATATCCTTGATCTCGTGGTCGAAAACGCAGATCCCCGCTACCCGATTAATCTAGACGAC
TTCATGTTCAAAAAACTCGGACTTCACCAGGTTGCTACTGTAAAAATCGTGAACAGCACG
ATTGGTTATATCGCCCCAATGCTTTCCAGGTGTCCATGACCTTTACGCAGTCAACCTATC
CAACAACAACCTAAAGAGCCTTCATCCTGAGACGTTTGCGAACAATAAGAAGCTGTTACT
TCTAACGCTTTCAAACAAT
(619 bp)

- SilkBase 1999-2022 -