SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20065
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf13
6731059 bp
UniRef
UniRef50_UPI00015B4C3D (67%/76)
Cluster: PREDICTED: similar to huntingtin interacting protein; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to huntingtin interacting protein - Nasonia vitripennis
Ontology
GO:0005515 F protein binding
GO:0005634 C nucleus
GO:0003677 F DNA binding
GO:0006350 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCACCTCAACCCGTACCGGCACTCGGACGCGCCGGCCGGCAGGATCACGTGC
ACGGCTGACTTTAAACACCTCGCCAGAAAGTTAACACACTTCGTAATGTTGAAAGAACTG
AAACATTGCCGCTCCGTCGAGGAACTTGTCGTCACCGATTCTGTACGATCTAAAGCGAAG
ACTTTCGTCAAAAAATACATGGCCAAGTTCGGTCCTGTGTACAAACGGCCACCCGAGGAA
GCAGACTAGGTACGCACTGCACAGATTAGGGCATAACAATTAGTACACGTCAGTGTCATG
TGACAGCAAACGTCACATCGTTCGACACATCTCGCCAGTGCTCGGTGTGAATCCACTATT
TTAACTTCATTCGAAGTATGAGATTGAAAACTAGACTTGTAATTATTTTGAACAAAGAAA
ATTGATTGAAGAATTTTCCAATGGATGATGATAGCCTTTTTGTAAATTTTGCCTTCGTTT
AAAATAGAATGAAGCAGATGAAAATATTTTTTGTAATGATTCAATGTGAAAGATAAAAGA
TCCTTCGTATATATGACATGTAAGAGTTATTAGGTGCAAATCAAAGTCGATGTAAAAAAG
TTAGTTCAATTCACTCAAACGAAATCATTTGAAATGAGGTACGTTTCAT
(649 bp)

- SilkBase 1999-2022 -