SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20064
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf10
7317751 bp
UniRef
UniRef50_Q1HQA2 (87%/100)
Cluster: ADP-ribosylation factor-like 6 interacting protein isoform 1; n=3; Bombyx mori|Rep: ADP-ribosylation factor-like 6 interacting protein isoform 1 - Bombyx mori (Silk moth)
Ontology
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGGCTGGTAAAATCTTCTCTTTTTGGTTACCTACAAACTTCGAATAATTTCC
TTGTAATTTATGAAAAAAGAAATCGAATTGCATTGCTTATTAAGTTTTTAATAAGAGTGA
CAAGAACAGTTAATTAAGGACGACAACTTTATCGCAAAAATGGGAGAGAAATCTAGTACA
GTCCAAGATCAGGAACAGCAAGTGCGAAAAGTAAAGCGAACTTTAGAAGGTTGGCGTGTA
GCCTTACTCTCTCTAAGTCTGTAATATTGTGGGAACAACAATGGCATCCTTGTGCCATTG
TGGGCTCAATGACAATTATGTATCTTCTCATTTGGTTATTAGATCTCAATACTCTAGCTT
CAATTGCTATTGTGGGTCTCATTCTTAATTTTGTTGATTTTATGGTACCAGTTATATGCA
ACCAGCTTTATGGATCTAGTTCTTGGACAGGACAACACGAGAAGACATTTGAAGAAATTT
GTAGAAGCATTGTAATAAGCTACAATAATTGGTGATTTACATCCATTCATTCTATTCCCT
ACGAGATACCAGCCCATTTATGTATTACACTATCTCCATCAGTACATTGTGTACTGTAGC
TTGGATATCCTCTTCTATTAACAACATTTTCCTGTTGTATTTATTGTCAACAGTAGTACT
GCTTTGGCCTGGCATACAGCGCATGGGATTTCAATAGTTTTTTTCTGTAGTGA
(713 bp)

- SilkBase 1999-2022 -