SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20063
JBrowseBomo_Chr22
chromosome_No.
Scaffold_id
Scaffold Length
chromo22
Bm_scaf61
2256882 bp
UniRef
UniRef50_P62701 (57%/134)
Cluster: 40S ribosomal protein S4, X isoform; n=137; Eukaryota|Rep: 40S ribosomal protein S4, X isoform - Homo sapiens (Human)
Ontology
GO:0000074 P regulation of cell cycle
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTTTCTTTCTCGATTTAATACTTGTCCAACATGGCGCGAGGCCCTAAGAAG
CATTTGAAGCGCTTAAACGCTCCCAAAGCATGGATGTTGGACAAACTTGGCGGTGTGTAT
GCACCGAGACCGTCAACCGGTCCCCACAAGTTGCGCGAGTGCTTGCCCCTGGTGATTTTC
CTGAGGAATCGTCTGAAGTATGCTTTGACCGGAAACGAAGTCCTGAAAATTGTGAAACAA
CGCCTCATAAAGGTGATGGGAAAGTTAGGACTGACCCTACTTATCCTGCTGGATTTATGG
ATGTTGTCTCAATTGAGAAGACTAATGAACTGTTTCGTCTAATCTATGATGTTAAGGGCA
GATTCACAATCCACCGTATCACCCCTGAGGAGGCTAAGTACAAGTTGTGTAAAGTCAAGC
GTGTGGCGACCGGACCTAAGAATGTTCCGTACTTGGTAACGCATGATGGCCGCACCATCC
GCTATCCAGACCCACTTATCAAAGTCAAGATTCCATCCAGTTAGACATTGCAACTACGAA
GATTATGGACTTCATCAAGTTTGAGTCCGGGAACTTGTGTATGATCACGGGAGGCCGTAA
CTTGGGGCGTGTGGGCACCATCGTGTTCCCGCGAGAGACATCCCGGCTCTTCGACATTGT
GCACATCAAGGACTCCACGGG
(681 bp)

- SilkBase 1999-2022 -