SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20062
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_Q4SP18 (88%/89)
Cluster: Chromosome 15 SCAF14542, whole genome shotgun sequence; n=4; Clupeocephala|Rep: Chromosome 15 SCAF14542, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0000166 F nucleotide binding
GO:0003924 F GTPase activity
GO:0005525 F GTP binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGCAGCTTATAAATGGAAATACAGAATATGCAGAATTCTTACACTGCAAGGG
AAAGAAGTTCACGGACTTCAATGAAGTTCGAGGAGAGATCGAGGCGGAGACAGATCGTGT
TACTGGTTCCAACAAGGGTATATCTCCTGTACCTATTAACCTGCGTGTTTATTCCCCGAA
TGTGCTCAACCTGACGCTGATTGATTTGCCGGGTCTGACAAAAGTGCCAATCGGTGATCA
GCCTATAGATATCGGCAGCAAATCAAAGGGATGATATTCCAGTTCATCAGACGCGAATCA
TGCCTTATCCTGGCAGTTACTCCGGCCAACACGGATTTGGCCAACAGCGATGCTCTGAAG
CTTGCCAAAGAAGTAGACCCACAAGGATTGCGTACTATCGGCGTAATAACAAAATTAGAT
TTGATGGACGAGGGTACCGATGCGCGGGACGTGCTCGAGAACAAGCTGCTGCCGCTGCGC
CGAGGCTACATCGGAGTCGTCAACCGATGCAGAAAGACATTGACGGTCGCAAGGACATAG
CCGCTGCACTTGCGGCTGAGAGAAAATTCTTCCTTAGCCACCCGTCATACCGTCATTTGG
CCGATCGTCTCGGTACCCTTACTACAGCGAGTGTT
(635 bp)

- SilkBase 1999-2022 -