SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20060
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_Q7PZX9 (81%/59)
Cluster: ENSANGP00000014054; n=2; Culicidae|Rep: ENSANGP00000014054 - Anopheles gambiae str. PEST
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
GO:0003723 F RNA binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGACACAAGGCTCGAAGATGACGAACTCCAAGGGTTACCNCNGCGGCACCAGG
GACTTGTTCGCTCGCAGTTCCGCACACATGGAACTATTCCGCTCTCCACGTACATGAAAG
TGTACAAAGTTGGAGACATTGTAGACATCAGAGGCAATGGTGCAGTTCAAAAGGGTATGC
CACACAAAGTATACCATGGAAAGACAGGTCGCGTGTACAACGTGACTGCTCATGCTCTCG
GTGTGATTGTCAACAGCGTGTTCGCGGAAGGATTATACCGAAGCGCATCAATATCCGTGT
TGAGCATGTCAAGCACTCCAAGTGCAGACAAGACTTCCTTAAGAGAGTCAAAGAGAATGA
GAGGCTACTGAAGGAAGCCAAGGCTGCCGGCAAGACCGTCAACCTGAAGAGACAGCCAGC
TCCCCCTAAAGCTGCCCACATCGTCAGTGGAACTGAGAAACCCGTCTTACTTGCGCCTAT
CCCATACGAATTCGTAGCGTAAAGTCCATAAAATATTTTTAAGAAAAAAA
(530 bp)

- SilkBase 1999-2022 -