SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20058
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
chromo17
Bm_scaf175
167828 bp
UniRef
UniRef50_Q6GLJ2 (41%/89)
Cluster: LOC443718 protein; n=4; Tetrapoda|Rep: LOC443718 protein - Xenopus laevis (African clawed frog)
Ontology
GO:0003899 F DNA-directed 5'-3' RNA polymerase activity
GO:0006350 P transcription, DNA-templated
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
CGGCACCTGTAATGAAAGCGAATCTCTGAAAGTGAATAATTTTATTCGCATGGATATTTA
ACTATTTGGAAACTTATAATAATGTCTAAAATCATAAAATTTGACCTACGAGAGTTAAAA
CAGTTGGCAAACGACAAAAATTCTTGTTTGGTTGTAAAAAAGATTACACAAAATCTGGCT
TTACAGCCATGGTGCCTTGGAAATATTAAAGAATCTATAACAAACTTATTAGATTATAAA
GTTGGTAAATTTGAAAAGAGTTGAACGGTGTCTTAGTAAGCTATAAAAATCCTTGTATAC
TTCAGAATGTTGGCACTATACGCAATGATAATGCGGATATACATTTCCAAGTTCAAGCGG
ATTACTTCATATTTCAACCATACATAGGTGCAAAATTAACTGGTTTAGTTAACAAAAAGT
GTTCCACACATTTAAGTGTCCTAGTACATAGAGTTTTTAATGTGGTCATACCACAGCCAA
CAGAAGAGCCTGGAGACAAGTGGATCGGTCTAGTGTTAAAGAGGGCCAAGAGGTCACTTT
TAGAATTGCTGCCTTAGACCTTTACGGAGCTCTTCCTTACATTAGAGGTGAATTAGATGA
GAGGAGTCTAAAAC
(614 bp)

- SilkBase 1999-2022 -