SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20057
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf2
11281751 bp
UniRef
UniRef50_Q17249 (98%/85)
Cluster: Urbain; n=1; Bombyx mori|Rep: Urbain - Bombyx mori (Silk moth)
Ontology
Orthologue
Sequence
(Nucleotide)
CGGCACGAGTGAAACTACACGCGGCCCTGTTGCTAACTATATTCGTGCTCGCCGCACGCG
CAGCCTGCCATCCCGGACAAGGTCCCCGAGGCCGAAGATAAACCTTTAAATGTCGTTGAT
AACTTATCTAGTGAGCAGGAGCTCATCGACCAGGCTAATACCATTAAAGACATCGATAAC
AGCCTCCGCGCGAACAAAAAAGAAGTCATCGACATCCCCGTTAAAGTTATCGTTGAAGAA
ATCAAACCGTCGTTAAGAGTGATTTAGAAAACGTTGAAGTGCCGGATGAAAATGAGGAAA
TCAAGAGGCCTCTAGTCGATTTAAGAAATCCCGGGCCCCCGCAGCATCAAGAGCACGAAA
CACAGAATCCTGAACACCACGAAGATGCTGAAAAAATCGTTTCTTCCGTCAAAAATGACA
TTAACACAGCGGAAATCGCTCTTCGTCAAGGCTTCCAGGAAGTGTCAGACGGTATTGGAA
AATGGTACGCTCGTACCGAGCAAATTAAGAGCTCCAGGCCAGCTTGCAACATTTCCAAGA
AAATTTCGGCGCTCAGATACAAAAGTTGAATGA
(573 bp)

- SilkBase 1999-2022 -