SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20056
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_P20030 (49%/234)
Cluster: Heat shock cognate HSP70 protein; n=9; Trypanosomatidae|Rep: Heat shock cognate HSP70 protein - Trypanosoma brucei brucei
Ontology
GO:0000166 F nucleotide binding
GO:0005524 F ATP binding
GO:0006950 P response to stress
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCAATCGCGCACGTTTGCTGAGTTGTTTTAAGAACAAGTAACAAGACTGATT
AAAAATACAAAATGGCAAAAGCACCCGCAGTAGGAATCGATCTGGGTACCACGTACTCTT
GCGTTGGTGTCTTCCAGCACGGGAAGGTGGAGATCATCGCCAACGACCAGGGCAACAGGA
CCACTCCGTCTTATGTTGCGTTCACAGACACCGAGCGTCTCATCGGAGATGCCGCCAAGA
ACCAGGTGGCGATGACCCCAACAACACAATATTCGATGCCAAACGTCTCATCGGACGTAA
GTTCGAAGATGCTACTGTGCAAGCCGACATGAAGCACTGGCCTTTCGAGTTGTCAGTGAT
GGAGGCAAACCTAAGATCAAGGTAGCATATAAGGGTGAAGACAAAACCTTTTTCCCCGAG
GAAGTCAGTTCCATGGTGCTTACGAAAATGAAGGAAACTGCCGAAGCTTATCTTGGCAAA
ACTGTGCAGAATGCAGTTATCACGGTTCCGCGTACTTCAATGACTCTCAAAGACAAGCCA
CAAAAGATGCAGGTACCATCTCTGGCTTGAACGTTCTCCGAATCATCAATGAACCGACTG
CTGCTGCGATTGCTTACGGTCTTGACAAAAAGGGTACTGGAGAACGAAATGTACTTATCT
TTGACCTCGGCGGCGGTACTTCGACGTGTCCATCCTTACCATCGAGGAGGTATCTTCGAG
GTGAAATCCACCGCGGCGACACCCACTTGG
(750 bp)

- SilkBase 1999-2022 -