SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20055
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_Q2VA67 (91%/84)
Cluster: Putative heat schock protein 70; n=1; Theileria sp. China|Rep: Putative heat schock protein 70 - Theileria sp. China
Ontology
GO:0000166 F nucleotide binding
GO:0005524 F ATP binding
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCGTCAATCGCGCACGTTTGCTGAGTTGTTTTAAGAACAAGTAACAAGACTG
ATTAAAAATACAAAATGGCAAAAGCACCCGCAGTAGGAATCGATCTGGGTACCACGTACT
CTTGCGTTGGTGTCTTCCAGCACGGGAAGGTGGAGATCATCGCCAACGACCAGGGCAACA
GGACCACTCCGTCTTATGTTGCGTTCACAGACACCGAGCGTCTCATCGGAGATGCCGCCA
AGAACCAGGTGGCGTGAACCCCAACAACACAATATTCGATGCCAAACGTCTCATCGGACG
TAAGTTCGAAGATGCTACTGTGCAAGCCGACATGAAGCACTGGCCTTTCGAGGTTGTCAG
TGATGGAGGCAAACCTAAGATCAAGGTAGCATATAAGGGTGAAGACAAAACCTTTTTCCC
CGAGGAAGTCAGTTCCATGGTGCTTACGAAAATGAAGGAAACTGCCGAAGCTTATCTTGG
CAAAACTGTGCAGAATGCAGTTATCACGTTCCCGCGTACTTCAATGACTCTCAAAGACAA
GCCACAAAAGATGCAGGTACCATCTCTGGCTTGAACGTTCTCCGAATCATCAATGAACCG
ACTGCTGCTGCGATTGCTTACGGTCTTGACAAAAAGGGTACTGGAGAACGAAATGTACTT
ATCTTTGACCTCGGCGGCGGTACCTTCGACGTGTCCATCCTTACCATCGAGGATGGTATC
TTCGAGGTGAAATCCACCGCCGGCGACACCCACTTTGGG
(759 bp)

- SilkBase 1999-2022 -