SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20054
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf5
8683647 bp
UniRef
UniRef50_UPI00015B50C7 (81%/82)
Cluster: PREDICTED: similar to GA14409-PA; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to GA14409-PA - Nasonia vitripennis
Ontology
GO:0004872 F signaling receptor activity
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0007165 P signal transduction
GO:0007275 P multicellular organism development
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATTTTTGTTATTTAAAGCTATAAAACATCAAATCGAAAAGGGAGTCGTCGA
TGCTATAACACACGAAGCTCGTTACTCTTTATCAGAAGAGAAGCTATTAAAAGAGCAGAT
TGACTATCAGACTGTAACCCTACACATTGTTCAAGACGAATTTGATGAAAAAGTTCAGTG
TAAAGTATTAGACTGTGACAGTATATCACAAGTAAAATCGAAGATACTAGATGCTCTCTT
CAAAAATACTCCATTTCACTCAGACCTGCTGTCCATGAAGTTGATCTCGAGTGGCGTCAT
GGTAGAGGTGGACATGTTACGCTTCAAGACGAGGATGTCACTACTAAAACATTAAATGGA
TGGCGAAAATTAAATACATTAGCCCATTATGGCGTTAAGGAATCCGCCATAATGTCGTTA
ATATCACGACAAAACGATAGTTTCAACACACCTTATAAAATACCATGTAAAAATTGTACA
GGAATATACTGTTCGAATTCACATATACCGTATACAATAGCGACATTACTGATCAAAACG
TGCATTATTATCATTTGGTAAAACCGATCGAATATCAACATATTGTCAACAAATCATCTG
AGCACAGTCACAAAGCCATTCCAGAAATATTTCTCACAGGCTGCTATCTACTAAAGGCAC
AGTACATAAATTTGTGG
(677 bp)

- SilkBase 1999-2022 -