SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20053
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf37
4206046 bp
UniRef
UniRef50_Q240Q6 (38%/44)
Cluster: ABC transporter family protein; n=1; Tetrahymena thermophila SB210|Rep: ABC transporter family protein - Tetrahymena thermophila SB210
Ontology
GO:0000166 F nucleotide binding
GO:0005524 F ATP binding
GO:0006810 P transport
GO:0015407 F ABC-type monosaccharide transporter activity
GO:0015417 F ABC-type polyamine transporter activity
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCTAACTTTTAGCATTCTCAAAATGTAAAAGGCGATGGACTAAATTATATGA
AGACATAAGGGTTAAATCAGTTACATGCCGTAAATTGAAAAAAAAGAAAACCAATATTTT
AGTGTCAATTGAAGACGTATCTTTTCCATCTAAAATACTTAAAAAAACGTCCTTTTCGCA
TTCCGTTGACGTATTGTCTTGTGTAAAACAATCAGTTGTTTATCCATTGAAGTATAAGTT
TTTCGCGTTCGAGCAAAATCGAAAGCTGCCATAGAAAACTCGTCGAAAGAGTACAAAATT
AATATTTTTGTGTAAAATTTTAGGGTGTAAGAGAAAAAAATCAGGGAGTCTCTAGATTAT
TAGGTTAAAAAAAATATTCTTGCCTGGTGCGATGTAAATTGGGAAATCGAAAAATAAATT
TGCTTATACGAAGAAGAAAAAAAGGGCGGCTACGGTAATTTCACTTTTATCAGAGATTTA
ATTAATAGTTTTTAACGTATTTAGGTGTATAAGCACGAATTTAATTTGTTGTTTTGTATT
ATTAATAGTGCTGTAGACTTAACTCGTATTGCTGCTTTTGAATGTATTTTGGGTTCATTG
TGAGACCCAAATTAATTTCTTATAAGATTTTAATTTTTTTCATTATTGAAGAAATCGTTT
TTCTTTTCCCCAATATTGAACTCAATATTGATCAATCCGTCATCTCATTTTTGTTTCTCG
TCACTTTTGTTTATAATTC
(739 bp)

- SilkBase 1999-2022 -