SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20052
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf16
6248677 bp
UniRef
UniRef50_Q9VUZ8 (61%/76)
Cluster: CG13072-PA; n=8; Eumetazoa|Rep: CG13072-PA - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003677 F DNA binding
GO:0005515 F protein binding
GO:0006915 P apoptotic process
GO:0006917 P apoptotic process
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCTACAAGGTACTTATGTACAGCTTTCGCAAAATATTAATTGATTTGTTGTG
AATTGTGACCCAGAGAAAACGATAAATTGCTTTAAAATGGATGATCCGGAATTAGATCAA
ATTAGACAGCAACGTCTAGCTCAATTACAGGCGCAGCAAGGGGGAACAGGTGACCCGAGC
AATGCCAAAGCACAACAAGAAAAAATGCAAGCAATGGAACAAGCTAAACACACTATATTG
AGTCAAGCGCTAAGCAAGATGCCCGAGCCAGATTGAACACAATCAAACTGGGTAGACCAG
AGAAAGCTGCCATGATTGAAAACATGATCTGTCGAATGGCCCAAATGGGTCAGATTCAAT
GTAAAATAACTGAACCTGATTTAATACAAATTTTGGAATCCTTTAATCAACAAATGCCCA
AATCTCAGAGCACCGTTAAGTTTGACAGAAGAAGGGCTGCATTGGACTCGGATGATGAAG
ATTTGTAAATGACTGTTAGTATAAGTTCATATAAGCTGTTTAAATATAATTATAAATATC
CTTCATGTTTTTGGTTAAAGTATCAATAAATAACACATTAAAATGTAGCTTAACCATCCT
AATCATTATTCATGTCAATTAATATTGAAAGAAAGTCTTACTTTTTTAATACAGTAGCTA
TTTTTGTATATCATTGAGATTGAA
(684 bp)

- SilkBase 1999-2022 -