SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20051
JBrowseBomo_Chr19
chromosome_No.
Scaffold_id
Scaffold Length
chromo19
Bm_scaf60
2449460 bp
UniRef
UniRef50_P13639 (59%/102)
Cluster: Elongation factor 2; n=491; Eukaryota|Rep: Elongation factor 2 - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0003746 F translation elongation factor activity
GO:0003924 F GTPase activity
GO:0005515 F protein binding
GO:0005525 F GTP binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGGCGTATGGTAGTTGGTTTAATAGAACAAAAATCATAAACCATCTAAAATG
GTGAATTTCACGGTAGACGAGATCCGTGGGATGATGGACAAGAAGCGGAATATCCGCAAC
ATGTCTGTGATCGCCCACGTCGATCACGGCAAGTCAACCCTCACGGACTCGTTGGTTTCC
AAGGCCGGTATCATTGCTGGTGCGAGAGCCGGAGAGACCCGTTTCACTGACACGCGTAAG
GACGAACAAGACCGTGCATCACCATTAAATCTACGGCCATCTCTATGTTCTTCGAGCTTG
AAGAGAAAGATTTAGTATTCATCACAAACCCTGACCAGCGTGAAAAGAGTGAGAAAGGTT
TCTTGATCAACTTGATTGACTCACCTGGACACGTTGATTTCTCTTCTGAAGTAACAGCTG
CACTCCGTGTCACTGATGGAGCCCTTGTGGTTGTTGACTGTGTGTCTGGTGTGTGTGTAC
AAACTGAAACAGTACTGCGTCAGGCTATGCCGAGCGCATCAAGCCTATTCTGTTCATGAA
CAAAATGGACCGTGCTCTTCTTGAGCTCCAACTTGAAGCTGAAGAACTATACCAGACGTT
CCAGCGTATTGTAGAAAATGTTAACGTCATTATAGCCACATATAACGATGATGGTGGTCC
CATGGGTGAGGTGCGTGTCGACCCTAGCAAGGGCTCTGTTGGTTTCGGGTCTGGTCTTCA
TGGGTGGGCTTTCACCCTCAAACAATTCTCTGAGATGTATGCGACAAATTCAAGATTGAC
C
(781 bp)

- SilkBase 1999-2022 -