SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20049
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf102
1187377 bp
UniRef
UniRef50_Q8IGP4 (97%/48)
Cluster: RE54276p; n=4; Endopterygota|Rep: RE54276p - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003951 F NAD+ kinase activity
GO:0008152 P metabolic process
Orthologue
Sequence
(Nucleotide)
CGGCACGAGTCGCCATGCGCGTGCTACCTGGTCACTCGCTGTGCAGTTGCCCGCGCATCA
TCACACTAGCTTCCAGTTCAAGAACACATTATATATTTACAATGAAATCTTTCGGTTAAG
CCTTTATTTTCCAATTTCCAAAACACAATCGTATTTATTATTAATGGTGACAAAAATTAT
CGTTCGTGTTTCAATCGTTTGATATGTGAAAATGATCGGTTTGTTCGCGAAACTAGTTTT
GGTAGCTCCGTGTGATTCGTGTAGCTGTTATGGCTCTGTTTAAAAAAATGTTGCGAAGGC
AGTATTCCCATGAGTCAGGCAAAACGGAACTTGTCAGAGCTCAGGAGGAGTACTTGGACA
GAAGGAGAACTAGATCCCTGAACGCGCCGTCCCCAATACAACAGTTTGGACCATGCGGCA
GGATTATGAAAAATTCCGCCATGGTCATGCAAATCCAGGATCCGGCGTCGCAGAGGCTGA
CCTGGTACAAGCCTCCCCTCACCGTGCTGTCATCAAGAAGGTTCACGACGCCCAGATACT
GGCACCCTTCGTTCAGCTAGTACACTGGCTCGTTCATGACAAAAGCATGGTGGTGTTCGT
CGAGGCGGCAGTTTTGGATGACACACTCCTTGCGGAGTAATGGGGG
(646 bp)

- SilkBase 1999-2022 -