SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20048
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf17
6395444 bp
UniRef
UniRef50_Q60F93 (94%/72)
Cluster: Molting fluid carboxypeptidase A; n=3; Endopterygota|Rep: Molting fluid carboxypeptidase A - Bombyx mori (Silk moth)
Ontology
GO:0004180 F carboxypeptidase activity
GO:0004182 F obsolete carboxypeptidase A activity
GO:0006508 P proteolysis
GO:0008270 F zinc ion binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGGCTGAGAGGCGGCGGTTCGTCGAAGCCCCCCGAACCAGCTCTGCAGTCAA
AACCGAACTTTACGTTCAGTAGCCATGGGATCCAAGAGGCAAACGGTCGTGTTGTTCTTG
GCGGCCCTAACCGTCGTTCTCAGCTCACCTCTGATCAATGAACTACAGCCCGGAGAAGAA
TGGCCACAACGCAATTCGGTAAGACAACCGGTAGCTGATGACCAAACAGAACAGACACTG
ACAGAGGACTTCTCACTGACGATCCGGCCCCAGCCGCAGTTGTTGAAGATGCAATAATAG
TAGCGAAAACAATTGAACGCGATCATGAGCCGAAAAAAATTGATTACTCCGGTTCACAAG
TGTGGCAAGTTTCCACTACAAAATCTGGAGCTCGTCAAGTAATCGGAAGACTTCGACGAA
GAAACCTGATTTCTACATGGGGCGGGAATCAGTCTTCTGTGGACATCCTTATCAAACCGA
ATGTCGTAGAAAATATTACACGTGTTTTAAAAGAGAGAGCATAGACTACAACGTCGTGAT
AGAAGATTTACAAAAGAGGATCAATGAGGAAAATCCGCCGCTAGATAACGATGAAATTGA
ACTGCAAGACAGACGAGGTCACCGAATGACATGGAAACAGTATCACAGATTAGAAGACAT
TTACGGCTTTATGGATTACTTGGCAAAACCTATCCTTCTATCATCAGTGTGAAATCAATA
GGAAATCATTTGAAGGTCGAGATCTTAAGATACTCCGCATATAAACGGTAA
(771 bp)

- SilkBase 1999-2022 -