SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamewdS20047
JBrowseBomo_Chr18
chromosome_No.
Scaffold_id
Scaffold Length
chromo18
Bm_scaf94
1624255 bp
UniRef
UniRef50_A6GYV7 (37%/53)
Cluster: Putative uncharacterized protein; n=1; Flavobacterium psychrophilum JIP02/86|Rep: Putative uncharacterized protein - Flavobacterium psychrophilum (strain JIP02/86 / ATCC 49511)
Ontology
GO:0000226 P microtubule cytoskeleton organization
GO:0000922 C spindle pole
GO:0005815 C microtubule organizing center
GO:0005488 F binding
GO:0003674 F molecular_function
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCCGCAGAGGACGTAAGCGCTCAGCCCGCGTCCGTCTTCCGCAACGCACGCT
CCACAAAACTAGAACCGTGCCAGGTGTCGGTGCCGTGATGTCGAAACAGTGAAACATTTG
TGTGCAATTATCAGCTTCCTTCCCATTCGGATATCGGATTGCGTTACGAGTTTCACCATG
GGCGACTCACTTTTGAAAGAAGATCCGCTGTCAAGGATCCAGAGAGAGATCATCGAAGTC
ACAGAGAGGGAAAGGAATTTAAAGAAGGTCACTTCAGAGTCAACAGGCTTATGTCCGAAT
CTACGATCGACGTTAATCATCAGAATGGACACATGAACGGCGATGCTGATGAGAAAATAT
CACGGACCCTCAACAGAGCGGTCTCCACTTCACATTTGTTAGGGCCCATCGCCCCCTCGA
CTCCTGCAGCGCCTGCTGCCCTCACCGCAAATGGTTACACGCGTCGATTCACTCCGCAGA
CCGGTACAAAAGGAATAATGCAAAGATTATAGCCAGCAAAGGAAAGCTGCCCCCGCCTTC
AAATGCGGCCTCAACACCGAATACGGCCATCGCCCCTCCCCTTATTTTCCCCTCGACTCC
AGTATTGGCACCAGTAGTTTCCCTCCTATCATCACTCGTACGCCTGAAGGGAGACCAGT
(659 bp)

- SilkBase 1999-2022 -