SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20045
JBrowseBomo_Scaf010
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf12
6701349 bp
UniRef
UniRef50_Q9VR47 (73%/53)
Cluster: CG12787-PC, isoform C; n=8; Diptera|Rep: CG12787-PC, isoform C - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005515 F protein binding
GO:0015105 F arsenite transmembrane transporter activity
GO:0015137 F citrate transmembrane transporter activity
GO:0015746 P citrate transport
GO:0016021 C integral component of membrane
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTGGGGTAACATTTGCGGACGGACGACCTGGAAGTGAGTCTTTAAATCCGC
TTCCAGCAGTTAAGTCCTAATACGGTCAGAGATCAATGCCAGGCAAAAACGCAGTGGCAT
ATAATCAGGTACAGTGAGGCTACGACCAAGTGGCCTATCATGATCGGGAAGCCTATTTTG
AAGAAGTTCATGAAGGTGAACTTGTATCCGTGTTGCTCAGCCACGCCAGCGCAGACCACG
TTGGCGCTCGCGCCATCAGGGTACCGTTACCTGGTAAGGAGGGCCCGGTTAGGTCTATAC
CGCTTCAATGTTTTTTATTTCTTAGTTGGGTGGACGAGCTCACAGCCCACCTGGTGTTAA
GCGTTACCAGAGCCCATAGACATCTACGACGTAAATGCGCCACCCACCTTGAGATATAAG
CACTAAGGCCTTAAGTATAAAGTTACAACGGCTGCCCCTCCCGAGTAGTAGTAAAAATGA
ATGACCAGTGAAAATGATAGGCACTGCCATCTCGACATCTTCTCAACAAGACTATTCTCG
AACTTTGAAAATGGTCACGTCATGGCGTCTAGGGAATACTGTGGAGGTTTCTACCACATT
TTGCCACGTACCATCCGGCTTTGGAATGAGCTCCCCTTCACGGTATTTTCCGAGCGCTAT
GACATGTCCTTCTTCAAACGAGGCTTGTGGAGATACTTAGGTAGCGGCTTGGTTCTGCCC
TG
(722 bp)

- SilkBase 1999-2022 -