SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20041
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_UPI00015B62FD (64%/85)
Cluster: PREDICTED: similar to glutamate carboxypeptidase; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to glutamate carboxypeptidase - Nasonia vitripennis
Ontology
GO:0004180 F carboxypeptidase activity
GO:0005515 F protein binding
GO:0006508 P proteolysis
GO:0008233 F peptidase activity
GO:0008237 F metallopeptidase activity
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATAAAATTGCCGGCAACGAAACAGCTTGTACCATTTTTTCCTGCTTATCAT
CAACATTATTCAGTGAGTTCCAAACAAGTTTCTGCAAAAATGGCAACGGAAAAAACATTG
CCTGAAATTTTTAAATACGTAGATCAGAATAAAGATTCTTATAAGCAATTATTAAAAGAA
GCAGTAGCCATTCCATCCGTTTCATGTGATGTGAAATATCGTGCGGATTGCATCCGTATG
GTTCACTGGATGCAGACAAATTGAAGGAAGTCGGAGCCACTACAGAGTTAAGGGATGTTG
GCTTTCAAACAATAGATGGCAAAGACGTTCAACTGCCGCCAGTTTTAGTAGGCGTATTGG
GTAATGATCCAAAAAAAAATACAGTTTGTATCTATGGTCATTTGGATGTACAACCTGCAT
TGAAATCTGATGGATGGGAGACTGAACCTTTTGAACTAGTTGAGCGCAATGAAAAATTAT
ATGGAAGAGGTTCTACTGATGATAAAGGCCTGTACTTGGTTGGCTGCATACCATCAATGC
CTATAAGGGCACTGGTGCTGAGCTGCCTGTCAATTTGAAGTTCATTTTCGAATGTATGGA
GGAATCTGGTTCCGAAGGCTTGACAGCTTATTAATGGACAAATTGAAACCTGAGGGATTC
TTTGATAGTGTAGACTATGTATGTATATCCGATAACTATTGGTTGGGAACCACGAAGCCA
TGTATCACCAATGGTTTACGCGG
(743 bp)

- SilkBase 1999-2022 -