SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20040
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
chromo24
Bm_scaf115
864725 bp
UniRef
UniRef50_Q7KRU8 (66%/80)
Cluster: CG2216-PA, isoform A; n=18; Endopterygota|Rep: CG2216-PA, isoform A - Drosophila melanogaster (Fruit fly)
Ontology
GO:0005488 F binding
GO:0005515 F protein binding
GO:0006826 P iron ion transport
GO:0006879 P cellular iron ion homeostasis
GO:0008043 C intracellular ferritin complex
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGCGAATAGGACTTATTTATTTGAATTTCCTGCGAATTATAAGTCGCCTTCT
ACGCCAGTGTGTGTAAAGGCTTGACTTATACAACTACTGCTTTCACGAGCACATATTTTT
TTGAATATCGTCAAAGAATCTGTGATTATAAGAGAAATTAAGATGAGGGCTGTTTTCTTT
GCTGTCCTCGGACTCGTTGCTGCCCTAGTTCCTGCCACAGCTACACAGTGTTACGTCAGC
CCCGTCACCATCAGGATGAGTGGCTCACCATGGAGCAGACTTGCTACAACATGATGAGGA
AACAGATCCAGGAGGAAGTGGCCGCGTCAATCCAGTACTTAGCCATGGGGGCTTACTTCT
CGATCGATACGGTGAACCGCCCCGGCTTCGCGAAGCTATTCTTCGATGCTGCGACTGAAG
AACGCGAGCACGCGACCAAGCTCATTGACTACCTGCTCATGAGGGGAAAGCTGACAGGCT
CCGTAACCGACCTCATCACGTACAGGGCCCCGCAAACACGTCGTGGGAGAGCGGCGCATC
AGCCCTCGAGCACGCCCTCAAGCTGGAGAGTGACGTCACCAACAGCATCCGGGAGGTCAT
CAAGACCTGCGAGAGCAGCTTCAACGACTACCACCTGGTCGACTATTTGTCCGGGGAATT
CCTCGACGAACAGTACAAGGGCAACGCGACTCGCCGGCAAG
(701 bp)

- SilkBase 1999-2022 -