SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20029
JBrowseBomo_Chr4
chromosome_No.
Scaffold_id
Scaffold Length
chromo4
Bm_scaf13
6731059 bp
UniRef
UniRef50_Q4SP80 (80%/82)
Cluster: Chromosome 15 SCAF14542, whole genome shotgun sequence; n=5; Euteleostomi|Rep: Chromosome 15 SCAF14542, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0003676 F nucleic acid binding
GO:0004386 F helicase activity
GO:0005524 F ATP binding
GO:0008026 F helicase activity
GO:0016787 F hydrolase activity
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATTTTACATTGCAATTGAATTAGAAGAATGGAAGCTGGAAACTCTGTGTGA
CCTGTATGATACACTGTCTATTGCACAAGCTGTAATTTTCTGCAACACCCGTCGCAAGGT
GGATTGGCTCACTGAATCTATGCATCTGCGTGACTTTACTGTATCTGCTATGCATGGAGA
CATGGATCAACGTGAGCGTGAAGTGATCATGAGGCAGTTTCGTACTGGCTCTTCTCGTGT
CTTGATCACCACTGTTTATTGGCACGTGGTATTGATGTACAGCAAGTTTCCTGCGTCATC
AACTATGATCTGCCATCCAACCGTGAAAATTATATTCACAGGATTGGACGAGGTGGACGT
TTTGGTCGTAAGGGAATTGCTATCAACTTTGTGACTGAAGCTGACAGGAGAGCACTGAAG
GATATTGAGGACTTCTACCACACTAGTATCGTTGAAATGCCCAGTGATGTGGCCAACCTC
ATCTAAGGCGCCTACATTTTTCCGATTTTATTCTGTGTCCTGCGTTCTATTGCGATATTT
ATAAGGTGTGTGTATTAGGACAAGACTCCTAACTACCTAACACTGCCGAATTTTTATTGG
AACTTATTTCATTTGGACCGATATATTCATTTTAGATTTAATTAATGAATACACTATACT
ATAGACGTATCAATATAAGTTTAATATACATAGGTAGGAATAAGCCCGGCTTTGC
(715 bp)

- SilkBase 1999-2022 -