SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20027
JBrowseBomo_Chr8
chromosome_No.
Scaffold_id
Scaffold Length
chromo8
Bm_scaf19
6098939 bp
UniRef
UniRef50_A0FDQ8 (98%/85)
Cluster: Putative uncharacterized protein; n=1; Bombyx mori|Rep: Putative uncharacterized protein - Bombyx mori (Silk moth)
Ontology
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCAACGATCACACATTAAATTAATATTTTACTTAAACAATTTGTGTCAGTGT
TTTTAAAAGCGGCGTCGCGTACACAGGATCCATATTTAAGATGAAGGTCTTACTATTGTG
CATAGCCTTCGCGGCTGTGAGTTTGGCGATGCCAGTGGCGGAGGAAAAGGACGTATTCCC
GCTCAACCAATTCTAGAAGTCGCGCCCAAAATTGATGACTCGGTTAAACCTACCGAAGTA
GCTGCTGCCACTGAGAGAAGAAAGCCGAACCTGCTCCAGTTAGTAACGACGAGGTACCCG
CTATACCAGAGGCCAAAAAGGACGATATAGCCCCAGAAGACTCCGATATCGCGAAACCGG
AAACCGTTCCTGAAGTGAAAACCGAAGAAAAAGTCCCGGAAGCAAAATCATCCGAGATTC
CCGATGCTGAAGCAAAATCTGCTGATATTAAAGTGGAAGAACCAGCTGCTCAGCCTGAAG
ATTCAAAAACTGAAGTACAAGCTACCGTGCTGAAATTTCAAAAGAAGAAAAACCTAGTGC
TACTGATGCAGAAGGTTCTGCCGACTCAGCTGCCATCATTCCCAACATGGTGAAGAAGAT
CGACTTGGCTCCTACTGTAGAAAGCGATGCTGCTGCAATTCCTGAAATTAAGACTCCTGA
AGCAGCCGATGCTCCTAAGTTAGCAGACAATCCTGTAGATGAGGACAAGCCTGCTGACAT
TTCACCTGATGCGCCGAAAGCTGAAGCTAAGTCGGCTGATGATCTGCGACTACAGCTAA
(779 bp)

- SilkBase 1999-2022 -