SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20024
JBrowseBomo_Chr6
chromosome_No.
Scaffold_id
Scaffold Length
chromo6
Bm_scaf11
6993210 bp
UniRef
UniRef50_A7TZA3 (37%/51)
Cluster: DNA-directed RNA polymerase II large subunit; n=2; Lepeophtheirus salmonis|Rep: DNA-directed RNA polymerase II large subunit - Lepeophtheirus salmonis (salmon louse)
Ontology
GO:0003899 F DNA-directed 5'-3' RNA polymerase activity
GO:0005515 F protein binding
GO:0003824 F catalytic activity
GO:0051536 F iron-sulfur cluster binding
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATCTAAACAAGTGACGTAGTATCTCGCTTCGATACCTACCTAATCGGAAAG
TCGGATCTCTAAATTCACTATTCTGGGCCGTGATCAAATAAGTATTTCGAGTGTTTTGAA
ATTTTAGTAGTAAATTTACCGAAATAGAAAATGTCTAGATATCCATACGGAAACCCAAAT
TATCCCCCACCCCAAGGACCAATTTACCCATCGCTCTACAATCCTGCAAATGCTCCACCT
CCTGGCCAGCCTAAGTACCACCAAATTATCCTGTGCCTGGTTATAATGTTCAACATTCAT
TCCAACCCGGGTATAGTCTCGGACAACAACCTGCAGCAATGTCTTACCCAGGAATCACGC
CAGCACCAACTGCACCTCGCGGCCATGTGACACCACATGGTGCATTTGGTTATCAAAGCT
ATCCTTATGTGACACCAACCCAGAGCTATGATACAACAATTGAATGGGTTCCTACAACTC
CTCAAAATGCTTCGATACTTAGCGAGAAGCAGTGGTGGCTGGTTATGAAGGTCACGATGG
TAGTCCCCTTGGGTGATCAG
(560 bp)

- SilkBase 1999-2022 -