SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20021
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
chromo3
Bm_scaf17
6395444 bp
UniRef
UniRef50_P62913 (64%/142)
Cluster: 60S ribosomal protein L11; n=156; Eukaryota|Rep: 60S ribosomal protein L11 - Homo sapiens (Human)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005730 C nucleolus
Orthologue
Sequence
(Nucleotide)
CGGCACGAGACCACCGCCTGCGTTGAAGAAAGATAAAAAGGAGAAGAAGGTTCCGAAGAT
AATTCTAAAAATGTAATGCGGAATCTTCATATCAGAAAGCTTTGCTTGAACATCTGTGTT
GGTGAATCCGGTGACAGGCTGACTCGTGCCGCCAAGGTGTTGGAGCAACTCACAGGAAAC
AGCCTGTATTTTCCAAGGCTAGGTATACAGTGCGGTCTTTTGGTATCCGTCGTAATGAAA
AGATTGCTGTCCATGTACAGTCCGAGGGCTAAAGCAGAAGAGATCCTTAGANGGTTTAAA
GTCAGAGAATATGAATTGCGGCGTGACAACTTCTCCGCCACGGGTAATTTTGGCTTCGGT
ATTCAAGAACACATTGACTTGGGTATCAAGTACGATCCCTCAATTGGAATTTATGGACTG
GACTTTTACGTCGTACTTTGCCGGCCAGGTTTCAACGTTGCACACAGAAGGCGTAA
(476 bp)

- SilkBase 1999-2022 -