SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20017
JBrowseBomo_Chr10
chromosome_No.
Scaffold_id
Scaffold Length
chromo10
Bm_scaf30
4522305 bp
UniRef
UniRef50_A5D417 (35%/73)
Cluster: N-terminal domain of molybdenum-binding protein; n=1; Pelotomaculum thermopropionicum SI|Rep: N-terminal domain of molybdenum-binding protein - Pelotomaculum thermopropionicum SI
Ontology
GO:0003700 F DNA-binding transcription factor activity
GO:0006355 P regulation of transcription, DNA-templated
Orthologue
Sequence
(Nucleotide)
CGGCACGAGATAAAAATGTAAATACCCATAATTATCAGTATCCGTATCCGGACCTAAAAA
ATGAAGTGTCATCAAATTATATCGAAGCGTAGATATCTAATAATACCAATTAAAAAGTTG
TACATACAATATGCGACACCATTATTAACCCTTTTAGTGCTGAGCTTTTCAAATATTATG
CAGAAATGGCAAAGGGATTTTTGAAAAAAAAGTTCCTTATTAAAAACTTTAACTTAAAAA
AATTAATGCTAAATCACAGCAAAATAATTTTAAATAGTTGTTAAAAGCCTTAAATGCGTC
CGTACAGGTCGATACTTAATACAAATAATCAAACAGCACAATAGTCGGTATTCCGACGCT
CCGTACTTTATACGCATAGAGAGTCGAACTATCGACGGTTCACGCTCAAAGGGTTAATAT
GTAATTAACGCCCGGTTCCACAATGCATGGCGCATTCTCGCAGCCTCAAAAGACCGGGCA
CGTCACATTTTATTGTGTGTGCCTGCCGGCCCCGCTAATGATCTAAAAATGTAGGTGTAA
CTAATGAGACTTTATTATTGATTCTTCCACTTCCACTAAAAGCTTCCAGTACCGGCTCGG
AGCGAGTTCAAAACGAAGCTCACCACTGCGGTGGTCAGCTTACGATCCGTGTGCTTAGTG
CGAGTTTTTAGCTTCCCTTCGTTGCCGCCAGGGCGCTGTTTTAACTCCATACAAATTGAA
GTTAACTTTGACGCCATCGAGTACGTAAAAAACTCGCATTAAC
(763 bp)

- SilkBase 1999-2022 -