SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20015
JBrowseBomo_Chr23
chromosome_No.
Scaffold_id
Scaffold Length
chromo23
Bm_scaf22
5301712 bp
UniRef
UniRef50_Q4SLB2 (47%/67)
Cluster: Chromosome 7 SCAF14557, whole genome shotgun sequence; n=1; Tetraodon nigroviridis|Rep: Chromosome 7 SCAF14557, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0003676 F nucleic acid binding
GO:0004527 F exonuclease activity
GO:0005622 C intracellular anatomical structure
GO:0004518 F nuclease activity
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
GGCACGAGAATTGCTCTAAATTCTTCATTATATATAATAAAGTATTATTGATATACAAAG
CAATTTAATAAACTTGGTCGTGATTATAATTAGATTAGTATAGATAATATTGGTGTAAAT
ATATTTCAGAAATAGTATGTATGTAATGTAATGTTGTACAACTATTAATTTCATTTTTTT
TGTGTAATGACATGCAGTTACGTTCAACATGTAAAGTCTATTTCACATTAAAACAATTAC
ATACAACATGATAAATCTACGTTATCACGAAGGCAATAACGTTCTTAACTCGTAATTTGT
CCATGTCTCCGAAAATAATGACGAAAAAAAATACTAAAGTTGACATAGCTCAGAGGATTG
TATGGATGGATCTTGAAATGACAGGACTTGACATTGAAAATGACCACATAATGGAAATAG
CGTGTCTTGTGACAGATGCACAGCTAAATGTAGTGGCGACAGGTCCCGATATAGTTATAA
ATCTACCTGAAGTGACTTTAAACAAAATAATAACTGGTGTAAGGTCCAACACGGCGAGAC
AGGGTTGACAGAGGCTTGCCTTAAATCAGACACATCATTAGCTGAAGCTGAGAGGATAAT
TCTGAAGTTTGTCAGTAATCATGTACC
(627 bp)

- SilkBase 1999-2022 -