SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20014
JBrowseBomo_Chr12
chromosome_No.
Scaffold_id
Scaffold Length
chromo12
Bm_scaf6
8265254 bp
UniRef
UniRef50_P50882 (44%/189)
Cluster: 60S ribosomal protein L9; n=17; Eukaryota|Rep: 60S ribosomal protein L9 - Drosophila melanogaster (Fruit fly)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005515 F protein binding
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTCAAACAAAGCCCAAACATGAAGCAAATTGTAGCAAATCAGAAAGTCAAA
ATCCCAGACGGGCTTACGGTCCATGTGAAATCGCGTCTGGTGACAGTTAAAGGGCCCCGC
GGAGTTCTCAAAAGGAACTTCAAACACTTGGCTGTTGACATTCGCATGGTAAACCCTCGT
CTCCTGAAGGTTGAGAAATGGTTCGGATCCAAAAAGGAGCTTGCCGCCGTGAGGACAGTC
TGTTCACATGTAGAAACATGATTAAAGGAGTAACTAAAGGCTTCCAATACAAGATGCGTG
CTGTGTATGCTCACTTCCCCATTAACTGTGTCACCACTGAGGGTAATTCAATTATTGAGA
TACGTAACTTCTTGGGTGAGAAATACATCAGAAGGGTAAAGATGGCACCTGGTGTGACTG
TCGTTAACTCTCCAAAACAAAAGGATGAACTAATCATTAGGCAACTCTTTCGAAAGATGT
CTCTAGCTCTGGTGCTCTCATCCAGCAACTACTACAGTCAAGAATAAGGATATCAGAAAG
TTCTTGGATGGTCTTTATGTATCTGAGAAAACAACTGTTGTGCTAGATGACATATAA
(597 bp)

- SilkBase 1999-2022 -