SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20013
JBrowseBomo_Chr17
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf131
685043 bp
UniRef
UniRef50_P15170 (95%/82)
Cluster: G1 to S phase transition protein 1 homolog; n=77; Eukaryota|Rep: G1 to S phase transition protein 1 homolog - Homo sapiens (Human)
Ontology
GO:0000082 P G1/S transition of mitotic cell cycle
GO:0000166 F nucleotide binding
GO:0000184 P nuclear-transcribed mRNA catabolic process, nonsense-mediated decay
GO:0003747 F translation release factor activity
GO:0003924 F GTPase activity
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGAAGAATTGGATACACAAGTAGGAAACACAAATCCTAACGAGGATGGTGAA
TTAACAAAAAAGATTCCAAAGAAAAAACCACCACGAGTAGAAGATACACGAAGCAAAAAA
GAACATGTAAATGTAGTATTTATAGGACATGTAGATGCAGGAAAGTCGACTATTGGTGGT
CAAATAATGTCACTCACTGGAATGGTCGACAAAAGAACATTAGAAAAATATGAAAGAGAA
GCGAGAGAGAAATCAGAGAATCATGGTACTTATCATGGGCACTGGACACAAATCAAGAAG
AACGAGACAAAGGCAAAACAGTAGAAGTTGGAAGAGCTTATTTTGAGACTGAAAAGAAGC
ATTTTACAATTCTTGATGCCCCTGGACACAAAAGTTTTGTTCCAAACATGATTGGTGGGG
CTGCTCAAGCTGACCTCGCTGTATTGGTCATTTCTGCACGTAAAGGCGAATTCGAAACGG
GTTTCGACAGAGGAGGACAAACTCGTGACATGCGATGTTAGCTAAAACAGCTGGAGTGAA
ACATTTGGTAGCACTTGTAAACAAGATGGATGATCCAACAGTTAACTGGGATGAGAAAAG
ATATAATGAATGTCGAGAAAAAATTTTGCCTTATCTTAAGAATTGGGTTTCAATACAGCG
AAAGACCTATCCTTCCTTCCTGTTTCCGGGCAAACTGGACAGGTTATTAGACGACTAACT
GAAG
(724 bp)

- SilkBase 1999-2022 -