SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20008
JBrowseBomo_Chr15
chromosome_No.
Scaffold_id
Scaffold Length
chromo15
Bm_scaf3
9954263 bp
UniRef
UniRef50_Q3T2L9 (63%/66)
Cluster: Rpl7A; n=2; Jakoba libera|Rep: Rpl7A - Jakoba libera
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
GO:0030529 C ribonucleoprotein complex
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGTTTGGTATACGATTTAGGTCACGTATCTTTTCGTGGCCTTTAAATCGCTG
AATTAATAACTGTTCAACATGGTGCAGAAGAAGCCTAAGAAGAAGGTAGGGAAGAAAGTA
GCCGCCGCCCCATTGGTGGTCAAAAAGGTTGAGCCCAAGAAGATCGTGAATCCTCTCTTC
GAGAAGAGGCCAAAGAACTTTGCCATTGGTCAGGGCATTCAGCCAACTCGGGACTTGTCC
AGATTTGTAAGATGCCCAAGTATATCCGCATCCAGCGCCAGAAGGCTGTACTTCAGCGTC
GTCTGAAAGTGCCCCCTCCGATCAACCAATTTACCCAGACACTGGACAAGACTACAGCTA
AGGGCCTTTTCAAGATTTTGGAGAAATACAGGCCTGAGACTGAAGCAGCCAGGAAAGAGA
GGCTGAGGAAAGCTGCTGAAGCTAAGGTTGCCAAGAAAGATGAGCCTCCACCAAAGAGGC
CCAACACCATCCGATCCGGCACAAACACGTCACCAAGCTGGTCGAGAAGAAGAAGGCGCA
GTTGTGGTCATCGCTCATGATGTTGATCCCATTGAGCTGGTTTCTCTTCCTGCCAGCGTT
ATGCCGTAAAATGGGCGTACCATACTGCATTGTCAAGGGCAAGTCCCGCCTCGGTGCACT
TGTACACCGCAAGACATGCACATGCTTAGCTCTAACAAATGTGGA
(705 bp)

- SilkBase 1999-2022 -