SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20007
JBrowseBomo_Chr24
chromosome_No.
Scaffold_id
Scaffold Length
chromo24
Bm_scaf107
1152854 bp
UniRef
UniRef50_P05141 (74%/91)
Cluster: ADP/ATP translocase 2; n=61; Eukaryota|Rep: ADP/ATP translocase 2 - Homo sapiens (Human)
Ontology
GO:0005215 F transporter activity
GO:0005488 F binding
GO:0005739 C mitochondrion
GO:0005743 C mitochondrial inner membrane
GO:0005887 C integral component of plasma membrane
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGACATATTCACCTAGTGAAGATCACATAATCGAACAAAATGTCGAACCTCG
CCGATCCGGTCGCGTTCGCTAAGGACTTCCTGGCTGGCGGTATCTCCGCCGCCGTCTCCA
AGACCGCCGTAGCACCAATCGAGCGTGTCAAGCTGCTGCTCCAAGTACAGCACGTCAGCA
AGCAGATCGCCGCCGACCAGCGTTACAAGGGTATCGTCGACGCCTTCGTCCGCATCCCCA
AGGAGCAGGGTCTCTTTCATTCTGGCGTGGTAACTTCGCCAACGTCATCAGGTACTTCCC
GACCCAGGCGCTCAACTTCGCCTTCAAGGACAAGTACAAGCAGGTGTTCCTCGGCGGCGT
TGACAAGAAGACGCAGTTCTGGCGTTACTTCGCTGGTAATCTGGCCTCCGGTGGTGCCGC
CGGAGCCACCTCTCTGTGCTTCGTGTACCCCCTCGACTTCGCACGTACCCGTCTCGCCGC
CGATGTCGGTAAGGGAGATGGCCAGCGTAATTCTCCGGTCTCGGAAACTGCATCAGCAAG
ATCTTCAAGTCCGACGGTCTGATTGGTCTGTACAGAGGTTTCGGTGTGTCCGTGCAAGTA
TCATCATCTACCGTGCCTCATACTTCGGTTTCTACGACACTGCCCGTGGCATGCTGCCCG
ACCCTAAGAACACACCCATTGTAATCAGCTGGGCATCGCTCAGACCGTAACACAGTCGC
(719 bp)

- SilkBase 1999-2022 -