SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20005
JBrowseBomo_Chr25
chromosome_No.
Scaffold_id
Scaffold Length
chromo25
Bm_scaf46
3255295 bp
UniRef
UniRef50_Q4RWQ6 (90%/77)
Cluster: Chromosome 15 SCAF14981, whole genome shotgun sequence; n=13; Bilateria|Rep: Chromosome 15 SCAF14981, whole genome shotgun sequence - Tetraodon nigroviridis (Green puffer)
Ontology
GO:0000166 F nucleotide binding
GO:0005524 F ATP binding
GO:0005525 F GTP binding
GO:0005622 C intracellular anatomical structure
GO:0006355 P regulation of transcription, DNA-templated
Orthologue
Sequence
(Nucleotide)
CGGCACGAGGATTGTTGTAAAAATGGCAAAAACTTACGATTGTTTATTCAAATTACTTCT
AATCGGAGATTCGGGAGTGGGAAAAACATCAATACTATTTAGATTTTCTGAAGATGCATT
TAACATCTCCTTTATATCCACAATTGGTATCGACTTTAAAATTCGAACAATAGACCTTGA
TGGCAAAAAAGTTAAATTACAAATATGGGATACTGCTGGTCAAGAGAGATTCCGTACAAT
AACAACAGCATACTCCGTGGTTCTATGGGAATTATGCTTGTCTACGATGTTACGAATGAG
AAGAGCTTTGAAAACATTAAGAATTGGATTAGGAACATTGAAGAGAATGCCAGTGCTGAT
GTTGAGAAAATGATACTTGGAAATAAGTGTGACTTAGATTCTCAAAGACAGGTATCAAAG
GAGCGAGGTGAACAATTAGCCATAGAATATCAGATAAAATTTGTGGAGACATCAGCAAAA
GACTCGTTAAATGTTGAATATGCATTTTCACTTTAGCCAGGGACTAAAAGCGAAAATGGA
AAAGAAACAGGAAGCGAGTAATCCGTCGGGCGGTAGGAGTGGCGTCCACAAGCCGACGCT
GAACGACGCTCGCAAGCCGGTGACGTGGCTGTCGCGTTGCAGCGTGCTTTGACCCCGTCT
GCACACTACGACCCCCGCCCCAGCCCTATTCTAACATTGTGGTACTTTGAACTGCCCACC
TTGACTATATTTTCTACCTACTTTACTTGACGGTGCGTTGACC
(763 bp)

- SilkBase 1999-2022 -