SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20002
JBrowseBomo_Chr8
chromosome_No.
Scaffold_id
Scaffold Length
chromo8
Bm_scaf19
6098939 bp
UniRef
UniRef50_Q5TUX2 (57%/45)
Cluster: ENSANGP00000025612; n=1; Anopheles gambiae str. PEST|Rep: ENSANGP00000025612 - Anopheles gambiae str. PEST
Ontology
GO:0042302 F structural constituent of cuticle
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCACACTCCTACAACGATCACTGTCGATGTCTAACGATTGTTAAGTGTAGTG
TTACTGTTGTGTCTATCGTGTCATATCTAAGATGAGTATATCAAAGTGGTTAGCATGCGC
TCTGCTTTTAGTATGCGTGAGCTTACGACAATCGATTGCAGCACCCGCGCTACAAGAAGA
ACAGTATCCCCCTATGCCGTACGAATACAAATACGACGTTGAAGATCCTGAGAAGACATT
GTACTTCGGCGCGACGAATCGGTGACGCTGAAGGCAAAGTCGTTGGGGGGTACCGAGTGC
TTCTTCCTGACGGTAGACTCATGACGGTCGAGTACACAGTACAAGGCGACAGTGGCTTTG
TACCCAAAATCAGTTTCGATAGTAACGCTAACCCCTTCGGTCAAGGAAAGTAAAGTTTCA
GCAAGATGTTTTCCGGCTTGTTTGTGTGTTTTGTTTCCGAATACCGAAAATAGCAGAAAA
TAACTATTTTCAAACGTTTTTTTTTCCGGTCATTTACTTAACTAACAATTTTGCAACTTA
ACTTCGTTTCAGGCATAATGTCAGTGATAGTGTTTTTCTTGTTTATTAAAATTATTAGTC
TAGAGCGTTTTTAATTTTGTGGTCTCTGTTTATTAAACAAGTAAAACGGCCAATCTAAAA
CCACACCAAATTAATCGCGAGATTCAATCATTTTTTACTCTCGAGTATTCACTTTCATTT
ATATATTTTTCA
(732 bp)

- SilkBase 1999-2022 -