SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/09/19
 
NamewdS20001
JBrowseBomo_Chr9
chromosome_No.
Scaffold_id
Scaffold Length
chromo9
Bm_scaf14
6760189 bp
UniRef
UniRef50_P11142 (58%/205)
Cluster: Heat shock cognate 71 kDa protein; n=239; Eukaryota|Rep: Heat shock cognate 71 kDa protein - Homo sapiens (Human)
Ontology
GO:0000166 F nucleotide binding
GO:0005515 F protein binding
GO:0005524 F ATP binding
GO:0005622 C intracellular anatomical structure
GO:0005634 C nucleus
Orthologue
Sequence
(Nucleotide)
CGGCACGAGCAATCGCGCACGTTTGCTGAGTTGTTTTAAGAACAAGTAACAAGACTGATT
AAAAATACAAAATGGCAAAAGCACCCGCAGTAGGAATCGATCTGGGTACCACGTACTCTT
GCGTTGGTGTCTTCCAGCACGGGAAGGTGGAGATCATCGCCAACGACCAGGGCAACAGGA
CCACTCCGTCTTATGTTGCGTTCACAGACACCGAGCGTCTCATCGGAGATGCCGCCAAGA
ACCAGGTGGCGATGACCCCAACAACACAATATTCGATGCCAAACGTCTCATCGGACGTAA
GTTCGAAGATGCTACTGTGCAAGCCGACATGAAGCACTGGCCTTTCGAGGTTGTCAGTGA
TGGAGGCAAACCTAAGATCAAGGTAGCATATAAGGGTGAAGACAAAACCTTTTTCCCCGA
GGAAGTCAGTTCCATGGTGCTTACGAAAATGAAGGAAACTGCCGAAGCTTATCTTGGCAA
ACTGTGCAGAATGCAGTTATCACGGTTCCGCGTACTTCAATGACTCTCAAAGACAAGCCA
CAAAAGATGCAGGTACCATCTCTGGCTTGAACGTTCTCCGAATCATCAATGAACCGACTG
CTGCTGCGATTGCTTACGGTCTTGACAAAAAGGGTACTGGAGAACGAAATGTACTTATCT
TTGACCTCGCGGCGGTACCTTCGACGTGTCCATCCTTACCATCGAGGATGGTATCTTCGA
GGTGAAATCCACCGCCGGCGACACC
(745 bp)

- SilkBase 1999-2022 -