SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30166.Seq
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf16
6248677 bp
UniRef
UniRef50_P07237 (58%/87)
Cluster: Protein disulfide-isomerase precursor; n=84; Eukaryota|Rep: Protein disulfide-isomerase precursor - Homo sapiens (Human)
Ontology
GO:0003756 F protein disulfide isomerase activity
GO:0004656 F procollagen-proline 4-dioxygenase activity
GO:0005515 F protein binding
GO:0005576 C extracellular region
GO:0005783 C endoplasmic reticulum
Orthologue
Sequence
(Nucleotide)
AGTAGGCTAGCAAAAAGGTGCCGATAATATCGAAATGCGTGTTTTAATTTTCACGGCTAT
AGCCCTGCTAGGGCTCGCTCTCGGAGATGAAGTGCCCACTGAAGAAAATGTGCTCGTTTT
GAGTAAAGCTAACTTTGAAACTGTAATTACAACCACGGAGTACATTTTAGTTGAATTCTA
TGCTCCATGGTGCGGCCACTGCAAATCTCTGGCACCGGAATACGCCAAGGCAGCAACAAA
GCTGGCTGAAGAAGATCTCCTATCAAACTAGCGAAAGTTGACGCAACTCAAGAACAGGAT
CTCGCCGAGAGCTACGGTGTACGAGGATACCCGACTCTCAAATTCTTCAGGAATGGCAGT
CCTATCGACTATTCAGGTGGTCGTCAAGCTGATGACATCATCAGTTGGCTGAAGAAGAAG
ACTGGCCCCCCTGCTGTTGAGGTCACCTCTGCTGAACAGGCTAAAGAACTTATCGATGCC
AATACTGTTATTGTATTTGGTTTCTTTTGGACCAGAGCTCAGCCAGAGCCAAAACTTTCC
TTTCAACTGCTCAAGTTGTTGATGACCAAGTATTTGCTATTGTCAGCGATGAGAAAGTGA
TCAAGGAGTTGGAGGCTGAAGATGAAGATGTTGTGCTTTTCAAGAACTTCGAAGAGAAAC
GTGTCAAATATGNAGATGAAGAAATCACTGAGGATCTGCTCAATGCTTTGGGGGTTGTCC
AGAGCATGGCTAACTATCGNTGAATTCTCCGCCTGAAACTGGTTTCCAAGATTCTTTTGG
TGGGGAAAGATTCCAAATACCCANCCTTCTTAACCTTCTTAATCCCAGAAAAAATGGGCG
GTTTTCGGGGAAAATANCCCTNGNGGGATTTTGAAAACCCGGTCCCCGAAGA
(892 bp)

- SilkBase 1999-2022 -