SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30165.Seq
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf192
108803 bp
UniRef
UniRef50_Q2F5X7 (98%/76)
Cluster: Nuclear Y/CCAAT-box binding factor C subunit NF/YC; n=1; Bombyx mori|Rep: Nuclear Y/CCAAT-box binding factor C subunit NF/YC - Bombyx mori (Silk moth)
Ontology
GO:0003677 F DNA binding
GO:0005622 C intracellular anatomical structure
GO:0043565 F sequence-specific DNA binding
Orthologue
Sequence
(Nucleotide)
ATTTTCAGTAATTGGCGATTGGAGATCTCCAAATAATACTCTGATTATTGGTTACCGTGT
TTATATTGCTTTCGGAACTTAGAGTAATTTACCAAAACATAGTTTAAGTATTAATTTTGA
GTGATAATTGAATAAAAACATCGGTGCGTTTGTCTCGTGAAGTTGGTTGAAAAAACTACA
AAATGTCCATGTGCTTCTTTGTGCCTGCCGAACAAACAACGACGGTTACCACGTCCGAAG
AAGTGGACGCTGATTTGCCGGTGAGGAGTCCTCCGCTGAGGCGGCGCACAAACCCTCCAG
CAGTTCTGGGACAAAGTCTTAGAGGACATACAGAAAGTTAATTCCGAAGACTTCAAGACC
CAAGCTTTGCCGTTGGCTCGCATCAAGAAGATCATGAAACTAGACGAGGAGGTGAAGATG
ATATCAGCAGAGGCACCGGTCTTATTCGCGAAGGCTGCTGAGATTTTTATACACGAGCTA
ACGTTGCGAGCCTGGTCGCATACGGAGGAAATAAAAGGCGGACTCTGCAGCGCAACGACA
TAGCGACAGTATATTGAAATCGGATCAGTTCGATTTCCTGATCGACATAGTGCCGCGGCA
TGAAGTCAAGCCGACGAAACCGCGTTACGACGCCGCCANGAAAGCCCCCAGCACGGATCA
GTACTACCTCCAGTTGGCGCANAGCATTCAGGCGGCCCTACAGAACAGTTCGCAGCCTCA
AATCGTGATACAGGCCCTGCGGCTCAAGTGGTACAGCNGGCGCGAGCACGGGCGGCGGCG
GCGGCGCCCGCTTAGCANNTTGGGGTCACGCANCAANCCGTTGGGCTTCTTGCAACAAGG
TCNTNAACCCCGGCCGGCNAAGTTNCAACAGCTTANCCGTTCCCAATTGAACGCAAG
(897 bp)

- SilkBase 1999-2022 -