SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30162.Seq
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_Q9GP16 (98%/67)
Cluster: 60S ribosomal protein L31; n=27; Coelomata|Rep: 60S ribosomal protein L31 - Heliothis virescens (Noctuid moth) (Owlet moth)
Ontology
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0006412 P translation
GO:0030529 C ribonucleoprotein complex
Orthologue
Sequence
(Nucleotide)
CTAGTCTCGAGTTTTTCTAAGTTGAATTCGGTACACGAAACTTAAGATAACAATGGCTAA
ACCCAAAGGTGAAAGAAAAGGCAAATCAGCCATAAACGAAGTTGTTACCCGTGAATATAC
AGTTAATTTACACAAACGACTTCATGGTGTTGGATTTAAAAAGCGTGCCCCAAGAGCAAT
CAAAGAAATCCGAAAGTTCGCTGAAAAACAGATGGGAACTCCGGACATTCGAGTAGACAC
TCGCTTAAACAAATCCTTTGGTCTAAGGGAGTCAGAAATGTTCCCTTCCGTGTCCGTGTG
AGGCTTTCACGAAGACGTAATGATGATGAAGATTCCGCACATAAGTTATTCACACTAGTG
ACTTACGTGCCTGTTGCATCTATCAAGGGTTTGCAGACAGAAAATGTTGATGCCAGCCAA
GAATAAACTCCTTTAGTATAAAAAAAAAAAAAAAAAAAACTCGAG
(465 bp)

- SilkBase 1999-2022 -