SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30161.Seq
JBrowseBomo_Chr8
chromosome_No.
Scaffold_id
Scaffold Length
chromo8
Bm_scaf161
275540 bp
UniRef
UniRef50_Q5QBM3 (67%/82)
Cluster: O-phosphoserine phosphatase; n=1; Culicoides sonorensis|Rep: O-phosphoserine phosphatase - Culicoides sonorensis
Ontology
GO:0003824 F catalytic activity
GO:0008152 P metabolic process
GO:0004647 F L-phosphoserine phosphatase activity
GO:0006564 P L-serine biosynthetic process
GO:0016791 F phosphatase activity
Orthologue
Sequence
(Nucleotide)
ATTCGACGGAGGCGTGTTCGTCGTATTTCCCGCAAAGTGGGTCTTTCATTATTACACTCG
TAACCTTTACGAAAGATAAGTAATACCGCAATCAGTAAATAAGATTGAAGTGAATTCGAT
CATAATAGTTTCGTTACTCGGAGAAGAAGCAACAGAGATGGCTCTTTACAGTTTGAAAAG
CAACCTGCAGTACGCGACGTTGAAGACGCTCTCACTGGTGTCGATCAGCGTGATGTCGCC
CCAACAGACTGTCCGGAGTTGTTCAGGACAGCGGACTGCGTTTGCTTCGATGTAGACTCG
ACCGTCATACAAGATGAAGGCATCGATGAACTGGCCAAGTTCTGCGGGAAAGGAGACGAG
GTTAAAAGACTGACGGCGGAAGCAATGGGCGGCAATATGACATTCCAGGAAGCCTTGAAG
AAGAGACTGGACATCATCAGGCCTAACGTCGGTCAGATCAGAGAATTCATTGAGAAATTT
CCAGTTAGACTAACTCCTGGTATTACAGGTTAGTGAAAGAGTTACACGAAAGAGGAGTCA
TCGTATATCTAGTTTCGGGCGGATTCAGGAGTCTAATAGAACCGGTCGCGGAGAGACTAA
ACATCCCAACTATCAACATCTTCGCTAATCGACTCAAGTTTTATTTCAATGGTGAATACG
CTGGCTTCGATGAAAACGAGCCAACATCGAGATCTGGTGGCNAANGTTTAGTGGTGAGAC
GACTGAANGAATTGCACGGGTACCAGCGCCTGGTGATCGTCCGGGGACCGGGGCTACCGA
TGCCCGAGGCTTAANCCCACCTGCTGACGGCTTCATTGGCTTCGGGGGGTNACCTTGGTT
CNTTGACGAANTCAAGGAAAGAANGCCAGCCTTGGTACGTCACGGGAC
(888 bp)

- SilkBase 1999-2022 -