SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30160.Seq
JBrowseBomo_Chr20
chromosome_No.
Scaffold_id
Scaffold Length
chromo20
Bm_scaf79
1594848 bp
UniRef
UniRef50_UPI0000E4A8D7 (56%/128)
Cluster: PREDICTED: similar to Pck1 protein; n=3; Strongylocentrotus purpuratus|Rep: PREDICTED: similar to Pck1 protein - Strongylocentrotus purpuratus
Ontology
Orthologue
Sequence
(Nucleotide)
AAGGAATTTTAAGACCTTTAGGTCAAGTCTTAAAATATAAAGTGAAATGAAATGAAATGA
AGATGACTAATTTGAAAAATTAGGTAATCAACTGGGATGAAACTAAATGGAATGGGATGA
GATGGACGCACAATGTACGTGATACCATTCTCGATGGGTCCTGTGGGATCTCCTCTCTCG
AAGATCGGCGTAGAAATCACGGATTCGCCTTACGTGGTTTATTCTATGCGAGTCATGACT
AGAATTGGAGCGAAGTTCTAGAAATTCTACGTCAAGACGAGCAGTTCGTTCGTTGTCTTC
ACGCAGTCGGCTCCGGTGGCACTCCGGGTTGGCCCTGCGACCCTAAGAACACCATCATAC
TCCACAAGCCGGCTGAGAACGAGATCGTAAGCTACGGCAGTGGATACGGCGGCAATAGTT
TGTTGGGCAAGAAGTGCTTCGCTCTACGTCTGGGATCAGTGATCGCTCGTCGCGAAGGAT
GGCTGGCCGAACATATGCTTATCGTCGGCATAACCAACCCTCAAGGTAAGAAGCGCTACA
TCGCTGCCGCTTTTCCTTCAGCTTGCGGGAAAACGAACCTTGCCATGATGACGCCAAACA
CTGGCCCGGGTACAAAGTAGANTGCGTGGGGGACGACATAGCCTTGATGAAGTTTCGACN
AAGGACGGCGTACTTCCGGGGCCATTTAANCCGGAAAAACGGGTTCTTTGGGAGTTGCAN
CCAGGTAANGTCANCCGGTAACGNATNCNATAAGCCAATTGGGAACCGGTNTTTCAAAAA
CANCCGTGTTCACTAAACGTGGCGGGAAAACANCTGAANGGTTNGGGGGTTTTGTTGGGA
AAGCATTGGGACCAAGTTCCCNGAAAGGNCTCGTTCNAANTGGGAAAAGGTCAAACCCTT
GGGA
(904 bp)

- SilkBase 1999-2022 -