SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30158.Seq
JBrowseBomo_Chr8
chromosome_No.
Scaffold_id
Scaffold Length
chromo8
Bm_scaf19
6098939 bp
UniRef
UniRef50_Q0N2R6 (56%/174)
Cluster: Signal recognition particle receptor beta subunit; n=2; Endopterygota|Rep: Signal recognition particle receptor beta subunit - Bombyx mori (Silk moth)
Ontology
GO:0004872 F signaling receptor activity
Orthologue
Sequence
(Nucleotide)
GTACATTCACTTTGTTTAATTTTTTAAAGTACATATTAATTTAGTGACTTAGTGAGTGTG
AAGCGAAAGAACTCTACAATGGAATCTGAAGTGGTTAAAGAAAAGATTCATACAGAACCG
ATCCTGAACGATCCACGATACATAACCTTACTTAGCCTTATTGTTCTAGCAGTAACCCTC
ATATTTTGGTGGATTTTCTCTCGAAGGTATACTCTTCGCAACTCAGTATTGTTAATGGGC
CTATCAGACTCTGGAANACTTTGCNGTTTGTAANACTCGCTTACTCNCAATACAGNCAGA
CTTTTACTTCNATGAAAGAAAATATTGAAGNGNATATAACTTCTAATAAAACNTTGAAAA
TAGTTGATCTGCCTGGACNAGAGAGACTGAGAAATAAATTCTTTNAACAGCACNAGAGTA
GTGCNAAGGGNATTGTGTTTGTGATTNATTCTATCAATATACNGGAAGAAATCNGAGATG
TAGCNGNATACCTATACACNATCTTGTGGATCCGATCATTCNGGGGAACACAACTCCCCN
TCTAATATTGTGGCAACAAACAGGNCCAGCCTTAGCCAAAGGNAGCCCAGTTATCCAAGG
GTTACTCGGAAAAGGAATTAATTTAGTTCGTGTGACCCAATCGGATCCACTGGCAGTCCG
TCGATTCGTCTGAAGGCNACATCCGGGGCGTTCCCAGGGAAAGANGGNNAAGATTCGGAT
TCTCNCNCCTTAGGAATTAAAGTCGAATTCCCCAGAGTGCTCGGCCNACACCGGATGACG
GTGGAAATNCCGCTGGGCATCAAGCCTCCTGCC
(813 bp)

- SilkBase 1999-2022 -