SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30156.Seq
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_P15880 (76%/108)
Cluster: 40S ribosomal protein S2; n=284; Eukaryota|Rep: 40S ribosomal protein S2 - Homo sapiens (Human)
Ontology
GO:0003723 F RNA binding
GO:0003735 F structural constituent of ribosome
GO:0005622 C intracellular anatomical structure
GO:0005840 C ribosome
GO:0005843 C cytosolic small ribosomal subunit
Orthologue
Sequence
(Nucleotide)
TTGACTGTCTATCAGAGCCCATCGTTCAACAATGGCGGACGCTGCTCCAGCCGGTGGACG
TGGCGGTTTTCGCGGCGGATTCGGATCACGCGGTGGAGATAGAGGCCGTGGCGGTCCTCG
TGGACGCGGTCGTGGTCGCGGCCGTGGTCGTGGGCGCGGCAAGGAAGACCAGAAAGAGTG
GGTTCCTGTCACCAAACTCGGCCGTCTTGTTCGCGAAGGAAAAATCGACAAACTCGAGAG
CATTTACTTGTTTTTTTACCAATCAAAGAATTCGAGATCATTGATTTCTTCCTCGGCCCG
TCCCTGAATGATGAGGTTCTTAAGATCATGCCTGTACAGAAACAAACACGTGCCGGACAG
CGCACACGTTTCAAGGCATTTGTTGCCATTGGCGACAACAACGGTCATATTGGTTTGGGT
GTGAAGTGCAGCAAGGAAGTCGCCACTGCCATTCGAGGCGCTATTATCCTTGCTAAGCTG
TCAGTTCTAACCAGTCCGAAGAAGTTACGGGGTAACAAGATAGGAAAGCCACACAACCGT
CCCTTGCAAAGTCANCGGGCAANTGTGGTTCCCTAAACAATTCCGGCTGATTCCTGCCCC
CTCCGTGGGTAATTGGTAATTGTGTTCTTGCGNCAAGTTTCCTAAAGAAAGCTTTCTTTC
AGATGGGCTGGGTGTTACANGGATTTGCTNACAACGTTCAAGCTTCNNTGGGTTTCAAAC
TTGGGNANCCTTNGGGGAAAATTTTGCTAAAAGCCCACATTACGCTGCCCATTTGGCCAA
AGAACAATAATGNCTTAACTTCAATTNCCTGAACTTTNTTGGAGGGGATAATNCCCCGCT
NGAACTAAANTTCTTCCAATAACTCCNNAGNTTCCNAAAGTCCTAAAGACAAATCCATTG
GTTTTAACNAACTTGNNTTAAAAAGAATTTTGNCCTTAAAAAAAAAAAAAAAAAAAAAAA
A
(961 bp)

- SilkBase 1999-2022 -