SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30155.Seq
JBrowseBomo_Scaf117
chromosome_No.
Scaffold_id
Scaffold Length
unknown

bp
UniRef
UniRef50_Q8GEG0 (100%/45)
Cluster: Putative uncharacterized protein; n=1; Erwinia amylovora|Rep: Putative uncharacterized protein - Erwinia amylovora (Fire blight bacteria)
Ontology
GO:0004553 F hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0005515 F protein binding
GO:0005618 C cell wall
GO:0005975 P carbohydrate metabolic process
GO:0003824 F catalytic activity
Orthologue
Sequence
(Nucleotide)
GCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTT
GCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCT
TCCCAACAGTTGCGCANCTGAATGGCGAATGGCAAATTGTAAGCGTTAATATTTTGTTAA
AATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCA
AAATCCCTTATAAACAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAA
CAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCA
GGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCG
TAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCC
GGCGAACGTGGCGAGAAAGGAAGGGAAGAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA
AGTGTAGCGGTCACGTGCGCGTAAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAG
GGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTC
TAAATACATTCAAATATGTATNCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATA
ATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGGCGCCTTATTCCCTTTTTG
CGGCATTTTGNCTTTCCTGTTTTTGCTCACCCAGAAAACGTGGTGAAAGTAAAAGATGCT
GAAGATTCATTTGGGTGCNCNAATTGGGTTACATCGAACTTGG
(883 bp)

- SilkBase 1999-2022 -