SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30153.Seq
JBrowseBomo_Chr11
chromosome_No.
Scaffold_id
Scaffold Length
chromo11
Bm_scaf35
4373199 bp
UniRef
UniRef50_UPI0000D55AA9 (73%/86)
Cluster: PREDICTED: similar to CG2101-PA; n=1; Tribolium castaneum|Rep: PREDICTED: similar to CG2101-PA - Tribolium castaneum
Ontology
GO:0005515 F protein binding
Orthologue
Sequence
(Nucleotide)
ACTAGATGTTTACAACATTTCAAATAATATAGAAAATGAGCATTTTAATCAAACGTTCTA
AGTCTGGGTGCTTCAATAGCGCCTGCAACGTTAAATTATGGCGTCTAAACTCTACTTCGG
CAGATTCCGCTCTGAAAAAGGGCGAAGAAGAAGAAGAATTTCGTGTACTAGATATCTTGA
AGAAAAGGGATAAAATGCAGCGTCGAGTAGTCAAAAGAACTGATGTGCAGCCAGATAGGA
TCGACAGGATGGCCCAAACCAGAACTGGGGGAATGTGTGGCCTGGTCCGAAAACTTTCCA
CCCGTCTTCGGTGCCATTACCGATACGTCAGGGCTACGTACCAAAGGGTCAAGCACCGCC
AGGTAAAAAAGCGAATGCAGAATTAATGAAAATACCAAATTTCCTTCACTTAACACCACC
AGTTATCAAGAGCCAGTGTGAAGCCTTAAAACAATTTTGTACGGAATGGCCGAATCTACT
CAACTCTGAGGAAAGTATAGAGAAGCATATCCCTTAGAAATTATAAGTTCAGATTACTGT
CACGCAAGTCCATCTATCCGTAACCCGTTAGCACGCGTCGTGATCTTAAGAGTTCAATTA
GCAGACCTCAAACTCGATAAACATGCAACAGACAAGTTTAAGAGGCTGGTCGGTGACAGG
TACGACCCAAAAACAGATTTAGTGACGATTCACAGCGGATTCGTTGTNCAACTAAAGTAC
AAAACTTTGGACTATGTCCATTTATTTGNTTGACTGGCATGCACCATGAGTCGTGGGAAT
TTTGAAGATTTGGGAGAAGGAGAAGACCCGAGGACGACATGGGGTATTATGGCTNGGGAT
AATAATGCTTCCAAGAGGGGTTTG
(864 bp)

- SilkBase 1999-2022 -