SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30152.Seq
JBrowseBomo_Chr12
chromosome_No.
Scaffold_id
Scaffold Length
chromo12
Bm_scaf109
991363 bp
UniRef
UniRef50_UPI00015B5529 (48%/82)
Cluster: PREDICTED: similar to AT19737p; n=1; Nasonia vitripennis|Rep: PREDICTED: similar to AT19737p - Nasonia vitripennis
Ontology
Orthologue
Sequence
(Nucleotide)
TTTCGAGTTATTTTTTACGGTTTTATTTTTTATTAAAAATTTATTTGACTAAATCTCGTT
TGTGTCGCGACAAGTTACTTTCGTTACGCGATTTTTTTGAAAACGTGACCTATTTTAATG
ATGTCTTTTACCTGAACGCGCAAAGAAATGGAAAACGACCCAAATAACAATCAGACGGCG
GGTCGGGAAACCGGTCGGTGCATGTCGGTGGCAGCGATGCAGGCGCTCCATCGACTGCGC
GAGTGTCGTCTGCTTGCGACGCTATTGTGCGCGCTGACGATGGCGCTTCCTTCCCCGTGC
ACCGTGCTATACTCTCAGCCTGCAGCCCATACTTCCTGGCACTGTTCACAACAACTCTTC
ATTCTCGGGAGCAAAGCGACGTATTGATATCCGGAGTGCGTTCTGAGATATTACTGCTGT
TGATTGAGTACGCCTACCTCCGCCGTATCGATGTCACAGATACCAATGTACATGAGCTCC
TAATGACAGCCGATTATCTCGCTTTCCTGGAGTGCTTCAGCTTTGTTGCGATCATCTCAG
AAGTTCATTGAACCCAAAAAACTGTCTTGGAATTATGACTTTTGCAAGGCGTGTTTTCTG
TTACAAACTCGAAGCGGATGCACGAAGGTATTTATTGCGTTACTTTGTAACAGTCGCAAC
ACAGAGCGACGAATTCCTTCACTTGCCACTGGACGAACTTAATTCTATTATATTGGAGGA
CGAATTAAAACGTTAAAAGTGAGGAAGCAGTTTTGGGAATCCTTTTGCGGTTGGGNCAAT
TAACGATTCCAGACGGTCCGATTGGCAGCACACCGGTNAAAATTAATTGGGCAGCATTCG
AACTTGGGGATTGCTCGACAACGCAAATCTTTCCTAA
(877 bp)

- SilkBase 1999-2022 -