SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30151.Seq
JBrowseBomo_Chr13
chromosome_No.
Scaffold_id
Scaffold Length
chromo13
Bm_scaf1
16203812 bp
UniRef
UniRef50_UPI0000D577BE (53%/64)
Cluster: PREDICTED: similar to CG13035-PA, isoform A; n=1; Tribolium castaneum|Rep: PREDICTED: similar to CG13035-PA, isoform A - Tribolium castaneum
Ontology
GO:0008137 F NADH dehydrogenase (ubiquinone) activity
GO:0016491 F oxidoreductase activity
GO:0042773 P ATP synthesis coupled electron transport
Orthologue
Sequence
(Nucleotide)
AAAACCANAAAAATCGTTTTAAAATTTTCAGTAACTATATGAAAAAATAAATAAATAAAA
ATACTCGTTTCATAAAATTATTTTTATTATCGGTTCGAATGCACCGTAGTCATGCCTCTA
AAAACCAAATCAATAACATGAGGCCTATGATTCTCGAAGATAGGACCGCTTTCACCTCTT
TGACTAATGATGACTCTGAACAACAACAAAAACCGGTAGAAGAACCACCGGAGGAGTGGG
CACCGTGGAGCTTCTGGTGCCTGCGAAGAATCCTCATGCACCACCACCGGTTTCCGTTAA
AACTACCGGCCCAGTTTGGGACATCGGACAGGTCTTAAAAGCGGCTCGTCTTCTCTGCAA
GCCACCACAGCAAGTCGATTTCGAGGACGAACAAGAAATGCGTTTCGTTTATTCTGTTAT
TTATGACGTTTTCCGATATAAATGTGTCTTGGACCAGGCCATGGACGATATTGAGTTCCT
GGCTGACTACCCACAGTACACCGGCAACGTCACATAGTTTGGCTATTCCTNATGGAGTTA
GCGAGACGTCGCTGGGAGGCCAGACCAAAGGCAGAGCAAGAACGCGCTACACAACTATTG
GGAAAGGCGCTGGNCAACCANTTTAAGGNAATTGAGAACGTTGTCTGGGAACNAAGAGTA
CACTTTCGCAGCTNCCATCGCTAGGATTCGTATAAAAAAATAAAGGCTCTCTCCGTTGTT
CCGGACCTATTTGCCCGGCCACCATTTGCGTTAAGGAACGCCTATTCAGCGTGGTGTCAA
TTAANGGNCNNTAATCCCCCGGGTTGGGGTTAAACACCNTTTTAAAGCCCCAAAAAAAAT
TNNCATTTNCNGGGTTAAAAAAATTTTCNCNGAACTTAGGGTTACTCCTTTA
(892 bp)

- SilkBase 1999-2022 -