SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30148.Seq
JBrowseBomo_Chr2
chromosome_No.
Scaffold_id
Scaffold Length
chromo2
Bm_scaf118
704489 bp
UniRef
UniRef50_Q8T5I1 (34%/82)
Cluster: Transcription factor; n=3; Culicidae|Rep: Transcription factor - Anopheles gambiae (African malaria mosquito)
Ontology
GO:0003677 F DNA binding
GO:0003700 F DNA-binding transcription factor activity
GO:0005634 C nucleus
GO:0045449 P regulation of transcription, DNA-templated
GO:0004872 F signaling receptor activity
Orthologue
Sequence
(Nucleotide)
AAAAAAACGGGTAAAAAACATCAAAATTCCAAGTGTCCCTTGATAATGCATCTATTGGTT
TATTTTATTATAATGGCAACAGTCATATGCGACGACTTCCAATATAATGATGACGAGGAT
GACTTCTATGACAGTGATGAGGATCCTGTAACGAGCACGATATCTGAAGGTCTGACTAAA
GCGAAGAGCTACAACGACAATGACCTCCGGACTCTGAATCCTCGGGAAGTGCGGGATGTC
AAAGACGCCCTGAACAGATATTTTCGAAGAGGAACATTGATCCGGAGCAAATTAAGGAGA
TAAACAATTATTACGACATCGAGACCACTGTTACAGTGGAATTTGATACGGGACAAGCAT
ACAGAGACTTTGTTGCCGGACCTTACTTCAGAAACAGAATCGAAGATCAAATAACGGAAA
GCTACAGACCGACCCGTTCTCCGGCGACCACTGTGCCGAGTGCTTATGATGACCCGGATC
CTCAGCTGTATTTTCGACAGGCAAACGTACTACTAGTCAAGCTCCGTCTTTAAAACCCAC
CGTAACCACTGCATCCACGACAAACACAAGCGCCGCTGTGACAACTGCTTCCGAAGTAGC
AGCTAAAGCGGAGACAACACCTAAACAAGAAACGACCACTAAATTCAACTAAAGAAGCGG
GCTGCAACGTCGAAAGGAGATACCAGCCTCTAAGGGCAGTTCACAACCTTCCAAAGCGGG
NCACAACCTCTAAAGCCGGTTACCATTCTTCTTGAAGCCGGNTACAACCCATTCAAATTC
GGGAAAACAAGTCTTCCAAGGCGGAATTACGG
(812 bp)

- SilkBase 1999-2022 -