SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30142.Seq
JBrowseBomo_Chr3
chromosome_No.
Scaffold_id
Scaffold Length
unknown
Bm_scaf196
110978 bp
UniRef
UniRef50_Q758T8 (35%/53)
Cluster: SWR1-complex protein 3; n=1; Eremothecium gossypii|Rep: SWR1-complex protein 3 - Ashbya gossypii (Yeast) (Eremothecium gossypii)
Ontology
GO:0005634 C nucleus
GO:0006350 P transcription, DNA-templated
GO:0006355 P regulation of transcription, DNA-templated
GO:0016568 P chromatin organization
Orthologue
Sequence
(Nucleotide)
TTTTTTTTTTTTTTTTTTTACTTCTTATTAATATATATTTTTATTTTAAGGCATAAAGCA
TTGAACAATTCAATCATTATACATCATTTTATTAAGCGAATTACTTAAGTTTACATTATT
CTCTATACATTAACAAGAAATTTCTTTGAATTTTGACAATTTAAAAAAAAAATTTTAATG
TAGGTAGGTACACTTAAAACGAAAGAGAGAAAGAGAGAGAGAGAAATCCAATGTATTTTT
AATTAACTGAATAAGCCAAAATGGCCACTACTGAAGTTTATAAATCATCGAAATTGTTCT
CTTTGTAAGTATGTATATATTTATTATTTTAACAAACGTAATTCTGAAGACTGTTAAAGC
ACCATAAACGGCCANATTTAAAATCTACATTTACACACTAACGAGACATATATACCGGGG
GAATTAATTTAATGTTCATAAGTTCTCACACGTGAGGTTCGTTTCACTGTTTATCCTCTT
GGCAACACTTCTATCTTCGTTACATCACGNACGTNTCCACCTCCATGTGTGCCGANCNGG
GGGCNGGGGCGGCGCTCTCAGGCGTCGCGCTGCACGTGGCGGCGCTTCAGGGGCGAGCGC
(600 bp)

- SilkBase 1999-2022 -