SilkBase IMG001 IMG002 IMG003 IMG005 IMG006 IMG007 IMG008 IMG009 kuwako IMG010 IMG011 IMG012

Last updated: 2022/11/18
NamepsV30141.Seq
JBrowseBomo_Chr16
chromosome_No.
Scaffold_id
Scaffold Length
chromo16
Bm_scaf4
9119588 bp
UniRef
UniRef50_Q14254 (46%/177)
Cluster: Flotillin-2; n=66; Eumetazoa|Rep: Flotillin-2 - Homo sapiens (Human)
Ontology
GO:0005515 F protein binding
GO:0005886 C plasma membrane
GO:0007155 P cell adhesion
GO:0008544 P epidermis development
GO:0009986 C cell surface
Orthologue
Sequence
(Nucleotide)
TGTCACTGTTGTTTTTATATTTATTGATTTTTCGGTAAATTAAACAAGTTTGTTATCGTT
TTAGTTGTGAAGTGCAGTGTGTGTATCGTGAAAGTCACTGTAAAAGGATTCAAAATGGGC
AACATCCACACTGTCGGTCCTAACGAGGCGCTAATAGTTTCAGGTGGCTGTTTCGGGCCG
ACCACGAAACGTACCATAGTGGGTGGATGGGCATGGGCCTGGTGTCTGGTTACGGACGTC
CAACGTATATCCCTGAAGTGATGACATTGAACCCGATGTGCGAGTACGTTGAAACGGCCC
AAGGAGTGCCGCTCACGGTGACCGGAGTCGCCCAGTGCAAGATCATGAACGAAGACGAAC
TTCTCACAACTGCCTGCGAGCAGTTCCTGGGCAAGACCGTCAAAGAGATTAAGATGACTG
TCCTGCAAACGTTGGAGGGTCATTTGCGAGCTATTCTCGGAACTCTTACAGTAGAAGAGG
TGTACAAAGACAGGGACCAATTCGCGGGTTGGTACGCGAAGTGGCTGCGCCGGACGTCGG
AAGAATGGGAATCGAGATTCTGTCCTTCACGATTAAGGACGTCTACGACGATGTCCAGTA
TCTGGGCCAGCTTGGGGAAGTTCGCAACGGCCAACGTGAAGAGGGACGCTGAACGTCCGT
GTCGCTCTGGCTAACCGAGATGCTGGTATTAGGGAAGCGGNATTGAGAAAAACGCAATGG
ACGTCAAAATATTCGATTGACACCCAAAATTGAAGGACAACAGAGACTCTTCAAAATTTC
AGAAAGGCGCCATTTTGATTCAAGGAATTTAAACNCCAGCTTAAAGCGGGAAAGGGCNTT
TTGGCNTTACGNACTTTCAAGCCAGCGGAAAATTAAACCAGGGGAATTCCCGAAACC
(897 bp)

- SilkBase 1999-2022 -